jag1a

Ensembl ID:
ENSDARG00000030289
ZFIN ID:
ZDB-GENE-011128-2
Description:
Protein jagged-1a [Source:UniProtKB/Swiss-Prot;Acc:Q90Y57]
Human Orthologue:
JAG1
Human Description:
jagged 1 [Source:HGNC Symbol;Acc:6188]
Mouse Orthologue:
Jag1
Mouse Description:
jagged 1 Gene [Source:MGI Symbol;Acc:MGI:1095416]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa168 Nonsense Available for shipment Available now
sa11248 Nonsense Available for shipment Available now
sa1989 Essential Splice Site F2 line generated During 2016
sa39691 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa168
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047851 Nonsense 438 1242 10 27
ENSDART00000123632 Nonsense 438 1242 10 28
ENSDART00000137172 Nonsense 438 1253 10 26
Genomic Location (Zv9):
Chromosome 1 (position 51640321)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50486818
KASP Assay ID:
554-0096.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTGCGTCAATGCCCACTCCTGCCGCAATCTGATTGGTGGATACTTCTGC[G/T]AGTGCCTGCCTGGCTGGACGGGACAGAATTGCGACATCAGTAAGTATTTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa11248
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047851 Nonsense 618 1242 14 27
ENSDART00000123632 Nonsense 618 1242 14 28
ENSDART00000137172 Nonsense 618 1253 14 26
Genomic Location (Zv9):
Chromosome 1 (position 51631075)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50477572
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACACGGCCGCTGCCKTAGCCACAGCCAYGCCGGAGGACACTTCAGCTG[C/A]GACTGTCAAGACGGCTTCACCGGGACCTACTGCCACGAGAGTAAGTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1989
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047851 Essential Splice Site 823 1242 20 27
ENSDART00000123632 Essential Splice Site 823 1242 20 28
ENSDART00000137172 Essential Splice Site 823 1253 20 26
Genomic Location (Zv9):
Chromosome 1 (position 51623395)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50469892
KASP Assay ID:
554-2934.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCGCTGTGAGTGCGCCAGTGGCTTYGCAGGACCAGACTGCCGCATCAG[T/C]GAGTGAATGCTTTATTCAGCATTTAGYAGTACGATTTTATTATAAAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39691
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047851 Nonsense 1057 1242 26 27
ENSDART00000123632 Nonsense 1057 1242 26 28
ENSDART00000137172 Nonsense 1068 1253 25 26
Genomic Location (Zv9):
Chromosome 1 (position 51619715)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50466212
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGCAAACACAGTGCTAACAGCTCCGTCATCGGCTCCATCGCTGAGGTT[C/T]GAGTGCAGCGCAAACAACCGCAAAACCCCAACGGTGAGACATCACAGCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Blood pressure: Genome-wide association study identifies six new loci influencing pulse pressure and mean arterial pressure. (View Study)
  • Bone mineral density: Association of JAG1 with bone mineral density and osteoporotic fractures: a genome-wide association study and follow-up replication studies. (View Study)
  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)
  • Cardiac hypertrophy: Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. (View Study)
  • Systolic blood pressure: Genetic variants in novel pathways influence blood pressure and cardiovascular disease risk. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link