idh3a

Ensembl ID:
ENSDARG00000030278
ZFIN IDs:
ZDB-GENE-040426-1007, ZDB-GENE-040426-1007
Description:
isocitrate dehydrogenase [Source:RefSeq peptide;Acc:NP_957245]
Human Orthologue:
IDH3A
Human Description:
isocitrate dehydrogenase 3 (NAD+) alpha [Source:HGNC Symbol;Acc:5384]
Mouse Orthologue:
Idh3a
Mouse Description:
isocitrate dehydrogenase 3 (NAD+) alpha Gene [Source:MGI Symbol;Acc:MGI:1915084]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38087 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38087
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039952 Nonsense 151 157 6 6
ENSDART00000103638 Nonsense 359 365 11 11
ENSDART00000124614 Nonsense 359 365 11 11
ENSDART00000128464 Nonsense 359 365 11 11
Genomic Location (Zv9):
Chromosome 25 (position 26772716)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 25733771
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATCTTGGTGGAAACTCGAAGTGCTCAGAGTTTACAGCTGACATCTGC[C/T]GAAGAGTGCAGGACATGGAATAAGGCTTTTCTAATATGTGCATTTAAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link