tnnt3a

Ensembl ID:
ENSDARG00000030270
ZFIN ID:
ZDB-GENE-000322-3
Description:
troponin T3a, skeletal, fast [Source:RefSeq peptide;Acc:NP_571640]
Human Orthologue:
TNNT3
Human Description:
troponin T type 3 (skeletal, fast) [Source:HGNC Symbol;Acc:11950]
Mouse Orthologue:
Tnnt3
Mouse Description:
troponin T3, skeletal, fast Gene [Source:MGI Symbol;Acc:MGI:109550]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24709 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24709
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103395 Nonsense 177 230 10 12
ENSDART00000125901 Nonsense 229 282 10 12

The following transcripts of ENSDARG00000030270 do not overlap with this mutation:

Genomic Location:
Chromosome 25 (position 32260155)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAACTATCAGGAAAGGTCTTATGTCTTTGTGTCATCAACTTCAGGGAC[A/T]AAGCACAAGAGTTGTACGAGTGGATAAAGACTCTGGAATCTGAGAAATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8yqnxjta