gtf3aa

Ensembl ID:
ENSDARG00000030267
ZFIN ID:
ZDB-GENE-041006-1
Description:
transcription factor IIIA [Source:RefSeq peptide;Acc:NP_001003866]
Human Orthologue:
GTF3A
Human Description:
general transcription factor IIIA [Source:HGNC Symbol;Acc:4662]
Mouse Orthologue:
Gtf3a
Mouse Description:
general transcription factor III A Gene [Source:MGI Symbol;Acc:MGI:1913846]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26628 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26628
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049331 Nonsense 35 367 1 9
ENSDART00000129565 Nonsense 33 365 1 9

The following transcripts of ENSDARG00000030267 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 70975986)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67315165
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTTCCTATCCGGAATGTCACGCGTATTACAACCGAGAGTGGAAGCTA[C/T]AAGCGCATCTCTGCAAACACACCGGAGAGGTCAGTTAACACACACACATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link