klhl36

Ensembl ID:
ENSDARG00000030251
ZFIN ID:
ZDB-GENE-050522-324
Description:
Kelch-like protein 36 [Source:UniProtKB/Swiss-Prot;Acc:Q503R4]
Human Orthologue:
KLHL36
Human Description:
kelch-like 36 (Drosophila) [Source:HGNC Symbol;Acc:17844]
Mouse Orthologue:
Klhl36
Mouse Description:
kelch-like 36 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2385305]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11523 Nonsense Available for shipment Available now
sa25056 Nonsense Mutation detected in F1 DNA During 2014
sa14457 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11523
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039585 Nonsense 33 605 3 6
ENSDART00000134920 Nonsense 38 76 3 3
ENSDART00000142942 Nonsense 69 107 3 3
Genomic Location:
Chromosome 18 (position 12678429)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YTCATAATCACCAGGTGTATCGATGKKYAGACCAAGCTAACAACCTCCTG[C/T]AAGGCTTAAATGAGCAACGACAGCATGGTCAAATGTGTGATGTGGTWCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25056
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039585 Nonsense 193 605 4 6
ENSDART00000134920 None None 76 None 3
ENSDART00000142942 None None 107 None 3
Genomic Location:
Chromosome 18 (position 12675986)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCCATCACTTCCGAGTTCCTCCAGGATGTGCGGATGTTCAAGCTTTG[T/A]GCTTACCTTTCCAGCGAACAAGTGCAATGCCTAAACGAGGAAACTCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14457
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039585 Nonsense 272 605 4 6
ENSDART00000134920 None None 76 None 3
ENSDART00000142942 None None 107 None 3
Genomic Location:
Chromosome 18 (position 12675749)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCCTCTGGACACAAGCTGCAAGGTGTTAGTTGAGGAAGCAATAGACTA[C/A]CACAGGAAGCTCAGCGCTCARCCTGTAATGCAGACACAGCGAACAGGCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Weight: Genome-wide association study of anthropometric traits and evidence of interactions with age and study year in Filipino women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gi5smeus