tmem30a

Ensembl ID:
ENSDARG00000030236
ZFIN ID:
ZDB-GENE-040704-26
Description:
transmembrane protein 30A [Source:RefSeq peptide;Acc:NP_997941]
Human Orthologue:
TMEM30A
Human Description:
transmembrane protein 30A [Source:HGNC Symbol;Acc:16667]
Mouse Orthologue:
Tmem30a
Mouse Description:
transmembrane protein 30A Gene [Source:MGI Symbol;Acc:MGI:106402]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39179 Essential Splice Site Mutation detected in F1 DNA During 2016
sa12779 Nonsense Available for shipment Available now
sa23190 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39179
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122747 Essential Splice Site 124 372 3 7
Genomic Location:
Chromosome 17 (position 50519840)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTGGTGACTGGATGTTATTTTAACCTCTAACTTCTTTTTTTTTTGTA[G/A]AGTAATGTTTTCATGTATTACGGACTCTCCAACTTCTATCAAAACCACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12779
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122747 Nonsense 168 372 4 7
Genomic Location:
Chromosome 17 (position 50519245)
KASP Assay ID:
2261-1598.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTWTAAATCTTTTGTTYTACAGAATCCGAGTAAAGAGTGTGAACCGTA[T/G]CGAACAAGTGACAGGAAGCCCATYGCTCCTTGCGGCGCCATTGCTAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122747 Essential Splice Site 309 372 6 7
Genomic Location:
Chromosome 17 (position 50516446)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACCCCAACACTACCGCCGGGAAACTACAGCCTGGAGGTCGCCTACAG[T/C]ATCCTTCACCAAACCCACACAAAGCCTTGTTCACACCAAGAATGAGCTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link