tmem30a

Ensembl ID:
ENSDARG00000030236
ZFIN ID:
ZDB-GENE-040704-26
Description:
transmembrane protein 30A [Source:RefSeq peptide;Acc:NP_997941]
Human Orthologue:
TMEM30A
Human Description:
transmembrane protein 30A [Source:HGNC Symbol;Acc:16667]
Mouse Orthologue:
Tmem30a
Mouse Description:
transmembrane protein 30A Gene [Source:MGI Symbol;Acc:MGI:106402]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12779 Nonsense Available for shipment Available now
sa23190 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12779
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122747 Nonsense 168 372 4 7
Genomic Location:
Chromosome 17 (position 50519245)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTWTAAATCTTTTGTTYTACAGAATCCGAGTAAAGAGTGTGAACCGTA[T/G]CGAACAAGTGACAGGAAGCCCATYGCTCCTTGCGGCGCCATTGCTAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122747 Essential Splice Site 309 372 6 7
Genomic Location:
Chromosome 17 (position 50516446)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACCCCAACACTACCGCCGGGAAACTACAGCCTGGAGGTCGCCTACAG[T/C]ATCCTTCACCAAACCCACACAAAGCCTTGTTCACACCAAGAATGAGCTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mcpkmt1r