
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
uchl3
- Ensembl ID:
- ENSDARG00000030177
- ZFIN ID:
- ZDB-GENE-050522-158
- Description:
- ubiquitin carboxyl-terminal hydrolase isozyme L3 [Source:RefSeq peptide;Acc:NP_001019576]
- Human Orthologue:
- UCHL3
- Human Description:
- ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) [Source:HGNC Symbol;Acc:12515]
- Mouse Orthologues:
- Uchl3, Uchl4
- Mouse Descriptions:
- ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) Gene [Source:MGI Symbol;Acc:MGI:13
- ubiquitin carboxyl-terminal esterase L4 Gene [Source:MGI Symbol;Acc:MGI:1890440]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11118 | Essential Splice Site | Available for shipment | Available now |
sa41404 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa11118
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000039760 | Essential Splice Site | 14 | 228 | None | 8 |
ENSDART00000104322 | Essential Splice Site | 14 | 230 | None | 9 |
The following transcripts of ENSDARG00000030177 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 9 (position 23009829)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 22165615 GRCz11 9 21976484 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATCTGAGATGGAGGGCCAGCGCTGGTTACCACTGGAAGCAAACCCAGAGG[T/A]AAGAGTWACTCCTCAATCTCACGGTCTTTCGCCGTGAATTCAGTTTTTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41404
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000039760 | Nonsense | 48 | 228 | 2 | 8 |
ENSDART00000104322 | Nonsense | 50 | 230 | 3 | 9 |
The following transcripts of ENSDARG00000030177 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 9 (position 23009208)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 22164994 GRCz11 9 21975863 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGTACGGCTTGGAGCTTGAAGTTCTCAGTTTGGTGCCAAGGCCTGTGTG[C/A]GCTGTACTTTTGCTCTTCCCTATAACAGAGAAGGTACAATTGCACTTTAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: