uchl3

Ensembl ID:: ENSDARG00000030177
ZFIN ID:: ZDB-GENE-050522-158
Description:: ubiquitin carboxyl-terminal hydrolase isozyme L3 [Source:RefSeq peptide;Acc:NP_001019576]
Human Orthologue:: UCHL3
Human Description:: ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) [Source:HGNC Symbol;Acc:12515]
Mouse Orthologues:: Uchl3, Uchl4
Mouse Descriptions:: ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) Gene [Source:MGI Symbol;Acc:MGI:13; ubiquitin carboxyl-terminal esterase L4 Gene [Source:MGI Symbol;Acc:MGI:1890440]

Alleles

There is 1 allele of this gene:

Allele name	Consequence	Status	Availability Estimate
sa11118	Essential Splice Site	Available for shipment	Available now

Mutation Details

Allele Name:: sa11118
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: T > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000039760	Essential Splice Site	14	228	None	8
ENSDART00000104322	Essential Splice Site	14	230	None	9

The following transcripts of ENSDARG00000030177 do not overlap with this mutation:

ENSDART00000142831

Genomic Location:: Chromosome 9 (position 23009829)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: ATCTGAGATGGAGGGCCAGCGCTGGTTACCACTGGAAGCAAACCCAGAGG[T/A]AAGAGTWACTCCTCAATCTCACGGTCTTTCGCCGTGAATTCAGTTTTTTT
Associated Phenotype:: Not determined

OMIM

OMIM information for UCHL3

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: