uchl3

Ensembl ID:
ENSDARG00000030177
ZFIN ID:
ZDB-GENE-050522-158
Description:
ubiquitin carboxyl-terminal hydrolase isozyme L3 [Source:RefSeq peptide;Acc:NP_001019576]
Human Orthologue:
UCHL3
Human Description:
ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) [Source:HGNC Symbol;Acc:12515]
Mouse Orthologues:
Uchl3, Uchl4
Mouse Descriptions:
ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) Gene [Source:MGI Symbol;Acc:MGI:13
ubiquitin carboxyl-terminal esterase L4 Gene [Source:MGI Symbol;Acc:MGI:1890440]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11118 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11118
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039760 Essential Splice Site 14 228 None 8
ENSDART00000104322 Essential Splice Site 14 230 None 9

The following transcripts of ENSDARG00000030177 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 23009829)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTGAGATGGAGGGCCAGCGCTGGTTACCACTGGAAGCAAACCCAGAGG[T/A]AAGAGTWACTCCTCAATCTCACGGTCTTTCGCCGTGAATTCAGTTTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zv83uaac