LOC569515

Ensembl ID:
ENSDARG00000030163
Human Orthologues:
CDK4, CDK6
Human Descriptions:
cyclin-dependent kinase 4 [Source:HGNC Symbol;Acc:1773]
cyclin-dependent kinase 6 [Source:HGNC Symbol;Acc:1777]
Mouse Orthologues:
Cdk4, Cdk6
Mouse Descriptions:
cyclin-dependent kinase 4 Gene [Source:MGI Symbol;Acc:MGI:88357]
cyclin-dependent kinase 6 Gene [Source:MGI Symbol;Acc:MGI:1277162]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40125 Essential Splice Site Mutation detected in F1 DNA During 2016
sa25258 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40125
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049720 Essential Splice Site 178 305 4 7
Genomic Location (Zv9):
Chromosome 3 (position 39173586)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39036946
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGTAGTGAGATCTTGCATGCAACGTATTTGTATGTTGTGTTTGTGTGT[A/G]GGTTGTGACTTTGTGGTACAGAGCTCCAGAAGTCCTGCTGCAGTCCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25258
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049720 Essential Splice Site 231 305 5 7
Genomic Location (Zv9):
Chromosome 3 (position 39172803)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39036163
KASP Assay ID:
554-7827.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTGTTTCGTGGCTTCACAGAGATCCAACAGCTGCAAAAGATCTTTGA[G/T]TGAGTCAAAAAGCTTATGTGTGGTTAATGTTGACTGGATTAATTTAAATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Celiac disease and Rheumatoid arthritis: Meta-analysis of genome-wide association studies in celiac disease and rheumatoid arthritis identifies fourteen non-HLA shared loci. (View Study)
  • Height: Genome-wide association analysis identifies 20 loci that influence adult height. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Identification of ten loci associated with height highlights new biological pathways in human growth. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)
  • Height: Meta-analysis of genome-wide scans for human adult stature identifies novel Loci and associations with measures of skeletal frame size. (View Study)
  • Rheumatoid arthritis: Common variants at CD40 and other loci confer risk of rheumatoid arthritis. (View Study)
  • White blood cell count: Genome-wide association study of white blood cell count in 16,388 African Americans: the continental origins and genetic epidemiology network (COGENT). (View Study)
  • White blood cell types: Identification of nine novel loci associated with white blood cell subtypes in a Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link