LOC569515

Ensembl ID:
ENSDARG00000030163
Human Orthologues:
CDK4, CDK6
Human Descriptions:
cyclin-dependent kinase 4 [Source:HGNC Symbol;Acc:1773]
cyclin-dependent kinase 6 [Source:HGNC Symbol;Acc:1777]
Mouse Orthologues:
Cdk4, Cdk6
Mouse Descriptions:
cyclin-dependent kinase 4 Gene [Source:MGI Symbol;Acc:MGI:88357]
cyclin-dependent kinase 6 Gene [Source:MGI Symbol;Acc:MGI:1277162]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25258 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25258
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049720 Essential Splice Site 231 305 5 7
Genomic Location:
Chromosome 3 (position 39172803)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTGTTTCGTGGCTTCACAGAGATCCAACAGCTGCAAAAGATCTTTGA[G/T]TGAGTCAAAAAGCTTATGTGTGGTTAATGTTGACTGGATTAATTTAAATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Celiac disease and Rheumatoid arthritis: Meta-analysis of genome-wide association studies in celiac disease and rheumatoid arthritis identifies fourteen non-HLA shared loci. (View Study)
  • Height: Genome-wide association analysis identifies 20 loci that influence adult height. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Identification of ten loci associated with height highlights new biological pathways in human growth. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)
  • Height: Meta-analysis of genome-wide scans for human adult stature identifies novel Loci and associations with measures of skeletal frame size. (View Study)
  • Rheumatoid arthritis: Common variants at CD40 and other loci confer risk of rheumatoid arthritis. (View Study)
  • White blood cell count: Genome-wide association study of white blood cell count in 16,388 African Americans: the continental origins and genetic epidemiology network (COGENT). (View Study)
  • White blood cell types: Identification of nine novel loci associated with white blood cell subtypes in a Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/awgmzwam