mybpc2a

Ensembl ID:
ENSDARG00000030157
ZFIN ID:
ZDB-GENE-060901-1
Description:
hypothetical protein LOC751793 [Source:RefSeq peptide;Acc:NP_001039324]
Human Orthologue:
MYBPC2
Human Description:
myosin binding protein C, fast type [Source:HGNC Symbol;Acc:7550]
Mouse Orthologue:
Mybpc2
Mouse Description:
myosin binding protein C, fast-type Gene [Source:MGI Symbol;Acc:MGI:1336170]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20031 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8124 Nonsense Mutation detected in F1 DNA During 2014
sa10086 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20031
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103457 Essential Splice Site 111 822 8 26
ENSDART00000103461 Essential Splice Site 100 1120 6 29
ENSDART00000121883 Essential Splice Site 100 1120 6 29
Genomic Location:
Chromosome 3 (position 30442661)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGACTTGTTCTCTAGAGCTGAGAGTTACCATTTATATTTCTCTGTCGC[A/G]GATTTACACCTATGAGATGACCATCGTTAAGGTCGTGGATGGAGATGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8124
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103457 Nonsense 155 822 9 26
ENSDART00000103461 Nonsense 144 1120 7 29
ENSDART00000121883 Nonsense 144 1120 7 29
Genomic Location:
Chromosome 3 (position 30443114)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCATCATCATCACGCATTTCATCTTCTCCTTCAGCTGCTGAGGAGACA[C/T]AGCAAACAAACATTTTGGAGGCGTTCAAGCGATCGTAAGTTTGTTTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10086
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103457 Nonsense 438 822 16 26
ENSDART00000103461 Nonsense 442 1120 14 29
ENSDART00000121883 Nonsense 442 1120 14 29
Genomic Location:
Chromosome 3 (position 30454313)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGCCGTCTTCAAATGTGAAGTTTCTGATGAGAAAGTGACTGGCAAGTG[G/A]TTCAAGGATGGGGTTGAGGTTGTCGCCAGTGACCGCATCAAAATGTCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3zbhcvg4