LOC560126

Ensembl ID:
ENSDARG00000030156
Human Orthologue:
NAGLU
Human Description:
N-acetylglucosaminidase, alpha [Source:HGNC Symbol;Acc:7632]
Mouse Orthologue:
Naglu
Mouse Description:
alpha-N-acetylglucosaminidase (Sanfilippo disease IIIB) Gene [Source:MGI Symbol;Acc:MGI:1351641]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13573 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13573
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048046 Nonsense 154 757 2 7
Genomic Location:
Chromosome 24 (position 37809055)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGGTTCAGGTACTATCAGAACGTGTGTACYGCCAGTTATTCCTCTGTGT[G/A]GTGGGATTGGCCAAGATGGCAAAGGGAGATCGATTGGATGGCGCTGAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e66fxvod