PAK7 (2 of 2)

Ensembl ID:
ENSDARG00000030154
Description:
p21 protein (Cdc42/Rac)-activated kinase 7 [Source:HGNC Symbol;Acc:15916]
Human Orthologue:
PAK7
Human Description:
p21 protein (Cdc42/Rac)-activated kinase 7 [Source:HGNC Symbol;Acc:15916]
Mouse Orthologue:
Pak7
Mouse Description:
p21 protein (Cdc42/Rac)-activated kinase 7 Gene [Source:MGI Symbol;Acc:MGI:1920334]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23829 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23829
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042607 Essential Splice Site 111 206 3 4
Genomic Location (Zv9):
Chromosome 20 (position 55029712)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 54908289
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCTGTGACTTCTGACCTGTGCTGGTGAGTCTGACCAGTCTGTGTGTGC[A/T]GGTGGACATCTGGTCTCTGGGCATCATGGTGATAGAGATGGTGGATGGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link