gnptab

Ensembl ID:
ENSDARG00000030153
ZFIN ID:
ZDB-GENE-030131-4714
Description:
N-acetylglucosamine-1-phosphotransferase subunits alpha/betaN-acetylglucosamine-1-phosphotransferase
Human Orthologue:
GNPTAB
Human Description:
N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits [Source:HGNC Symbol;Acc:29670]
Mouse Orthologue:
Gnptab
Mouse Description:
N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits Gene [Source:MGI Symbol;Acc:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40269 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40269
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040445 Nonsense 855 1222 13 21
ENSDART00000048782   None 106 None 8
ENSDART00000101154   None 327 None 14
ENSDART00000113990   None 139 None 8
ENSDART00000121714 Nonsense 852 1219 13 21
ENSDART00000132309   None 106 None 3
Genomic Location (Zv9):
Chromosome 4 (position 16757806)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 17700646
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCCGCGAGCGGCCAACTGGTCGTAGGCTTCAGTTTTACAGCGACAGCT[T/A]GAACAGAGGTTTCCTGCCGTGGGAGAAGAGGAAGTTCTTTCAGGATCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link