inppl1a

Ensembl ID:
ENSDARG00000030146
ZFIN ID:
ZDB-GENE-030131-3904
Description:
Phosphatidylinositol-3,4,5-trisphosphate 5-phosphatase 2A [Source:UniProtKB/Swiss-Prot;Acc:Q2I6J1]
Human Orthologue:
INPPL1
Human Description:
inositol polyphosphate phosphatase-like 1 [Source:HGNC Symbol;Acc:6080]
Mouse Orthologue:
Inppl1
Mouse Description:
inositol polyphosphate phosphatase-like 1 Gene [Source:MGI Symbol;Acc:MGI:1333787]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2819 Essential Splice Site F2 line generated During 2017
sa32068 Nonsense Available for shipment Available now
sa7296 Essential Splice Site Mutation detected in F1 DNA During 2017
sa7295 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa2819
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041897 Essential Splice Site 101 851 6 23
Genomic Location (Zv9):
Chromosome 15 (position 46455128)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 47002411
KASP Assay ID:
554-3263.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAAGTATTTCTGGATTTAATGATCTGCTTTTATTKATTTGTRTTTCTC[C/T]GTGATTGTTGGTTTTCTAGGAAACAAAGGTGCAGTGGGCGTGTCCTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32068
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041897 Nonsense 311 851 12 23
Genomic Location (Zv9):
Chromosome 15 (position 46450777)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 46997936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCAGTGTTTATTCCAGCTGTTTCTCTCTGCAGGTCTGCCAAAGTCTT[C/A]AGAGCAGGCCTACATTGAGTTCGAGAACATCGAGGCCATCGTGAAGACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7296
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041897 Essential Splice Site 455 851 15 23
Genomic Location (Zv9):
Chromosome 15 (position 46446776)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 46993936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGGCGGAGCTTAACAGTTAAACYCCGCCCCTACTCAATATYCATCTTC[A/T]GTTGGAAAYACATCATCAAACTTRATTTCYTTAAGCTGATAATAAWCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7295
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041897 Essential Splice Site 482 851 18 23
Genomic Location (Zv9):
Chromosome 15 (position 46446134)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNNNNNNNNNNNNNNNNNNCACACACAAACACACACACACACAYACACNNNN[C/A]CACACACACACANNGTAGCAGTGTTTCCATCCAAAGATGCCTATTAGCAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link