ENSDARG00000030129

Ensembl ID:
ENSDARG00000030129
Human Orthologues:
HIATL1, HIATL2
Human Descriptions:
hippocampus abundant transcript-like 1 [Source:HGNC Symbol;Acc:23376]
hippocampus abundant transcript-like 2 [Source:HGNC Symbol;Acc:23672]
Mouse Orthologue:
Hiatl1
Mouse Description:
hippocampus abundant transcript-like 1 Gene [Source:MGI Symbol;Acc:MGI:1913881]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41096 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41096
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050352 Nonsense 30 471 2 12
Genomic Location (Zv9):
Chromosome 8 (position 687670)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 554270
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCGAAGGTGGCCCATGCAGTGGTGGTGATCTTCATGGAGTTTTTCGCCT[G/A]GGGTCTCCTGACCACCCCGATGCTCACCGTGAGTCACTGATCAAAACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link