si:dkey-11e23.5

Ensembl ID:
ENSDARG00000030116
ZFIN ID:
ZDB-GENE-030131-8832
Description:
hypothetical protein LOC336888 [Source:RefSeq peptide;Acc:NP_001038220]
Human Orthologue:
KIAA0247
Human Description:
KIAA0247 [Source:HGNC Symbol;Acc:19956]
Mouse Orthologue:
4933426M11Rik
Mouse Description:
RIKEN cDNA 4933426M11 gene Gene [Source:MGI Symbol;Acc:MGI:2444661]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37055 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11637 Nonsense Available for shipment Available now
sa8975 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37055
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046042 Essential Splice Site 216 364 5 7
Genomic Location (Zv9):
Chromosome 20 (position 28918864)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28990077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGTTTGTTTTGCTTCAGCCAAAACTCAAGTCCTTCCATCACAGCCGG[T/C]GAGGCCCGTCTCCCTCTCATTGAGTGTTACGTCTTCAAAAACGAATGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11637
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046042 Nonsense 279 364 6 7
Genomic Location (Zv9):
Chromosome 20 (position 28917061)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28988274
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGTGCTGTCGGAGGGCCCTCAAGCTGAGGCTTTGCATGAACCKCTGGAA[C/T]AGGCTCAGGCGAGCTACAGTTTCCCTTCCACCTCCGCTGCWGCGAGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8975
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046042 Nonsense 279 364 6 7
Genomic Location (Zv9):
Chromosome 20 (position 28917061)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28988274
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGTGCTGTCGGAGGGCCCTCAAGCTGAGGCTTTGCATGAACCTCTGGAA[C/T]AGGCTCAGGCGAGCTACAGTTTCCCTTCCACCTCCGCTGCWGCGAGCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link