myod1

Ensembl ID:
ENSDARG00000030110
ZFIN ID:
ZDB-GENE-980526-561
Description:
Myoblast determination protein 1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q90477]
Human Orthologue:
MYOD1
Human Description:
myogenic differentiation 1 [Source:HGNC Symbol;Acc:7611]
Mouse Orthologue:
Myod1
Mouse Description:
myogenic differentiation 1 Gene [Source:MGI Symbol;Acc:MGI:97275]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu2023 Nonsense Confirmed mutation in F2 line Unknown
hu2024 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
hu2023
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027661 Nonsense 227 275 3 3
Genomic Location:
Chromosome 25 (position 32265402)
KASP Assay ID:
554-0029.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTGTCTGTCCAGCATCGTGGAGCGAATTTCCACAGAGACTCCTGCATG[T/A]CCCGTGCTGTCAGTACCGGAGGGGCACGAAGAGAGCCCGTGTTCTCCGCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
hu2024
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027661 Nonsense 273 275 3 3
Genomic Location:
Chromosome 25 (position 32265266)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCGTCCCCGACCAGCTGCCCTCAACAGCAGGCTCAGGAAACCATTTAT[C/T]AAGTGCTTTAAAATTCTGCAACATTTCAAAACAAATTGAAAAAGACAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qwm2qzzv