ccdc78

Ensembl ID:
ENSDARG00000030095
ZFIN ID:
ZDB-GENE-060301-1
Human Orthologue:
CCDC78
Human Description:
coiled-coil domain containing 78 [Source:HGNC Symbol;Acc:14153]
Mouse Orthologue:
Ccdc78
Mouse Description:
coiled-coil domain containing 78 Gene [Source:MGI Symbol;Acc:MGI:2685784]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3254 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa3254
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042273 Essential Splice Site 472 547 12 14
Genomic Location:
Chromosome 24 (position 39421534)
KASP Assay ID:
554-2604.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGGCAGATGTTAAAAGGCAGATCAGAGAAATAACAAACTCCACWCAGG[T/C]AACCAACACAAGCTGTYTAGATGTTAGCATATGGTCCGCTGATGCTAAAY
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9j7d2n9p