tram2

Ensembl ID:
ENSDARG00000030092
ZFIN ID:
ZDB-GENE-040426-2024
Description:
translocating chain-associated membrane protein 2 isoform 2 [Source:RefSeq peptide;Acc:NP_998236]
Human Orthologue:
TRAM2
Human Description:
translocation associated membrane protein 2 [Source:HGNC Symbol;Acc:16855]
Mouse Orthologue:
Tram2
Mouse Description:
translocating chain-associating membrane protein 2 Gene [Source:MGI Symbol;Acc:MGI:1924817]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23807 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23807
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043938 Nonsense 10 371 1 11
Genomic Location:
Chromosome 20 (position 47841280)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAAGTCGGGAACTTGTAAAATGGCTTTTCGCAGGAGAAACAAGAGTTA[T/A]CCCTTCTTCAGCCAAGAGTTTCTCATTCAGAATCACGCGGACATTGTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ml4afljb