plekha1

Ensembl ID:
ENSDARG00000030064
ZFIN ID:
ZDB-GENE-040426-2780
Description:
pleckstrin homology domain-containing family A member 1 [Source:RefSeq peptide;Acc:NP_998601]
Human Orthologue:
PLEKHA1
Human Description:
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 [Source
Mouse Orthologue:
Plekha1
Mouse Description:
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 Gene [S

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13035 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13035
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044876 Nonsense 342 401 12 12
ENSDART00000131929 Nonsense 341 400 12 12
ENSDART00000142178   247 272 8 8
Genomic Location (Zv9):
Chromosome 17 (position 21742057)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21892206
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCAKGYCACCCAGAACGCCATGGTCCCGCGAGGCCTGGCATGGGACAG[C/T]GAGCACTTCATGAGCCTGCTRCCCCTGCCCCGTCCACACGCCCGCCTGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Age-related macular degeneration: A genome-wide association study for primary open angle glaucoma and macular degeneration reveals novel Loci. (View Study)
  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link