eef1db

Ensembl ID:
ENSDARG00000030053
ZFIN ID:
ZDB-GENE-030131-6544
Description:
elongation factor-1, delta, b isoform 2 [Source:RefSeq peptide;Acc:NP_001025318]
Human Orthologue:
EEF1D
Human Description:
eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) [Source:HGNC
Mouse Orthologue:
Eef1d
Mouse Description:
eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) Gene [Source:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6656 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6656
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028648 Nonsense 479 578 6 8
ENSDART00000042704 Nonsense 199 298 6 8
ENSDART00000047264 Nonsense 455 554 5 7
ENSDART00000110777 Nonsense 175 274 5 7
ENSDART00000131647 Nonsense 199 298 5 7
ENSDART00000145230 Nonsense 455 554 7 9
Genomic Location:
Chromosome 20 (position 52916551)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAGGATGAAGAGGCAGAGAGACTCAAAGAGCAGCGGCTGCAAGAATA[C/A]GCCGCRAAAAAAGCCAAAAAACCTGCCCTCATCGCAAAATCATCCATCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rehgazf2