eef1db

Ensembl ID:
ENSDARG00000030053
ZFIN ID:
ZDB-GENE-030131-6544
Description:
elongation factor-1, delta, b isoform 2 [Source:RefSeq peptide;Acc:NP_001025318]
Human Orthologue:
EEF1D
Human Description:
eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) [Source:HGNC
Mouse Orthologue:
Eef1d
Mouse Description:
eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) Gene [Source:

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37176 Essential Splice Site Mutation detected in F1 DNA During 2016
sa6656 Nonsense Mutation detected in F1 DNA During 2016
sa37177 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37176
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028648 Essential Splice Site 318 578 None 8
ENSDART00000042704 Essential Splice Site 38 298 None 8
ENSDART00000047264 Essential Splice Site 318 554 None 7
ENSDART00000110777 Essential Splice Site 38 274 None 7
ENSDART00000131647 Essential Splice Site 38 298 None 7
ENSDART00000145230 Essential Splice Site 318 554 None 9
Genomic Location (Zv9):
Chromosome 20 (position 52903269)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 52756116
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAACGACGGTTTTACGAACAGATGAACGGACCCACAAAGCCCAAACAGG[T/C]AATGAATACCAGGGGGATATACAGTCGAAGACAAAATTATTATCCTCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6656
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028648 Nonsense 479 578 6 8
ENSDART00000042704 Nonsense 199 298 6 8
ENSDART00000047264 Nonsense 455 554 5 7
ENSDART00000110777 Nonsense 175 274 5 7
ENSDART00000131647 Nonsense 199 298 5 7
ENSDART00000145230 Nonsense 455 554 7 9
Genomic Location (Zv9):
Chromosome 20 (position 52916551)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 52769398
KASP Assay ID:
554-4718.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAGGATGAAGAGGCAGAGAGACTCAAAGAGCAGCGGCTGCAAGAATA[C/A]GCCGCRAAAAAAGCCAAAAAACCTGCCCTCATCGCAAAATCATCCATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37177
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028648 Essential Splice Site 501 578 6 8
ENSDART00000042704 Essential Splice Site 221 298 6 8
ENSDART00000047264 Essential Splice Site 477 554 5 7
ENSDART00000110777 Essential Splice Site 197 274 5 7
ENSDART00000131647 Essential Splice Site 221 298 5 7
ENSDART00000145230 Essential Splice Site 477 554 7 9
Genomic Location (Zv9):
Chromosome 20 (position 52916619)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 52769466
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACCTGCCCTCATCGCAAAATCATCCATCCTGTTAGACGTCAAACCTG[T/A]GAGTGATCCCCTTCAGTTTCACACACACACACACACACACACACACACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link