nup188

Ensembl ID:
ENSDARG00000030022
ZFIN ID:
ZDB-GENE-030131-7184
Human Orthologues:
NUP188, RP11-101E3.5
Human Description:
nucleoporin 188kDa [Source:HGNC Symbol;Acc:17859]
Mouse Orthologue:
Nup188
Mouse Description:
nucleoporin 188 Gene [Source:MGI Symbol;Acc:MGI:2446190]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9709 Essential Splice Site Available for shipment Available now
sa43571 Nonsense Mutation detected in F1 DNA During 2017
sa37216 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9709
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043431 Essential Splice Site 153 1732 7 44
Genomic Location (Zv9):
Chromosome 21 (position 4810006)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4387418
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTCTTCACCTCCTCACYTACTTCCAGGATGAGAGACATCCATAYAGGG[T/A]AATAATAATGACAGATCAGATTTATTATYGGCWGAGTTTGTTATTWTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43571
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043431 Nonsense 541 1732 16 44
Genomic Location (Zv9):
Chromosome 21 (position 4826507)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4403919
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTGTCTGTGGGTGAACAGGGTTTCCTGGTGCGCTGGGAATATTCCTA[C/A]AGCTCCTGGACTCTTTTCACCTGTGAGATCGAGATGCTGCTGCACGTCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37216
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043431 Nonsense 1441 1732 38 44
Genomic Location (Zv9):
Chromosome 21 (position 4853681)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4431093
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTATGTGCAGTGTCTGAATGCGGTACGGACGGTTCAGTCTCTGGCGTG[T/A]CTGGATGAAGCTGATCACACCGTGGGTTTTCTGCTCCAGCTCTCCAACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link