agfg1a

Ensembl ID:
ENSDARG00000030020
ZFIN ID:
ZDB-GENE-030131-5808
Description:
arf-GAP domain and FG repeats-containing protein 1 [Source:RefSeq peptide;Acc:NP_956129]
Human Orthologue:
AGFG1
Human Description:
ArfGAP with FG repeats 1 [Source:HGNC Symbol;Acc:5175]
Mouse Orthologue:
Agfg1
Mouse Description:
ArfGAP with FG repeats 1 Gene [Source:MGI Symbol;Acc:MGI:1333754]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4620 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4620
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043960 Nonsense 272 556 6 13
ENSDART00000124780 Nonsense 490 774 9 16
ENSDART00000144944 None None 225 6 7
Genomic Location:
Chromosome 15 (position 34468458)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACCACAGCAGCATTTCCATCAGCTCCACAGGCTCCATTTCAGCCCCCA[C/T]AACCAGGTAGACCACACACACACACACACACACACACACACACACACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zduv8tnc