agfg1a

Ensembl ID:
ENSDARG00000030020
ZFIN ID:
ZDB-GENE-030131-5808
Description:
arf-GAP domain and FG repeats-containing protein 1 [Source:RefSeq peptide;Acc:NP_956129]
Human Orthologue:
AGFG1
Human Description:
ArfGAP with FG repeats 1 [Source:HGNC Symbol;Acc:5175]
Mouse Orthologue:
Agfg1
Mouse Description:
ArfGAP with FG repeats 1 Gene [Source:MGI Symbol;Acc:MGI:1333754]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35962 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35962
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043960 Essential Splice Site 395 556 8 13
ENSDART00000124780 Essential Splice Site 613 774 11 16
ENSDART00000144944   None 225 None 7
Genomic Location (Zv9):
Chromosome 15 (position 34459857)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35305633
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTCAGTGCCAAATGTGAGCGGCTACCAAGCGGCCACTACAGCACAAGG[G/A]TGAGAATGTAAAGTCAAGATTTTCTGTTTTTCTCTCAACACCTTTTACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link