lrrfip1a

Ensembl ID:
ENSDARG00000030012
ZFIN ID:
ZDB-GENE-030131-99
Description:
Lrrfip1a protein [Source:UniProtKB/TrEMBL;Acc:A9JR77]
Human Orthologue:
LRRFIP1
Human Description:
leucine rich repeat (in FLII) interacting protein 1 [Source:HGNC Symbol;Acc:6702]
Mouse Orthologue:
Lrrfip1
Mouse Description:
leucine rich repeat (in FLII) interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1342770]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14421 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14421
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023196 None None 443 None 9
ENSDART00000039295 None None 244 None 8
ENSDART00000079689 None None 488 None 12
ENSDART00000101577 Nonsense 163 534 7 13
ENSDART00000126198 Nonsense 163 541 7 14

The following transcripts of ENSDARG00000030012 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 25138208)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATCCATGAGCTTAAGGATCAGATTCATGATGTGGAGGCAAAGCACATG[C/T]AGAACCTTAAAGAGCTAAAGGTATACCTCTGNNNNNNNNNNNNNNNGTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Adiposity: A Variant in the LRRFIP1 Gene Is Associated With Adiposity and Inflammation. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8txnyz0w