tnni2b.2

Ensembl ID:
ENSDARG00000029995
ZFIN ID:
ZDB-GENE-040801-9
Description:
troponin I, skeletal, fast 2b.2 [Source:RefSeq peptide;Acc:NP_001003423]
Human Orthologue:
TNNI2
Human Description:
troponin I type 2 (skeletal, fast) [Source:HGNC Symbol;Acc:11946]
Mouse Orthologue:
Tnni2
Mouse Description:
troponin I, skeletal, fast 2 Gene [Source:MGI Symbol;Acc:MGI:105070]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17285 Essential Splice Site Available for shipment Available now
sa5435 Nonsense Mutation detected in F1 DNA During 2016
sa38632 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17285
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099001 Essential Splice Site 27 187 3 6
ENSDART00000139240 Essential Splice Site 16 176 5 8
ENSDART00000146702 Essential Splice Site 16 176 4 7
Genomic Location:
Chromosome 7 (position 40784647)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCTGGCCAGTGTTAAATATCCAAGTGGCATTTGTTCATTGTTTGTTGT[A/C]GAGTTTGATTCTGGGTATAGCCAAAGACCTGCTGTCGGCTGAGCAGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5435
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099001 Nonsense 98 187 4 6
ENSDART00000139240 Nonsense 87 176 6 8
ENSDART00000146702 Nonsense 87 176 5 7
Genomic Location:
Chromosome 7 (position 40784949)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGGATGAGGAAAGATACGACATGTCTCTCAAAGTGGCCAAGAGTGAC[A/T]AAGAGGTTTTTGTTTTTCTCATTCCTCCGTCCTTATCCATCTCACTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38632
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099001 Nonsense 101 187 5 6
ENSDART00000139240 Nonsense 90 176 7 8
ENSDART00000146702 Nonsense 90 176 6 7
Genomic Location:
Chromosome 7 (position 40785049)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACTTTGGCTTGAATTTACAGCACATCACACTCTGTATTCTTGTAGATT[G/T]AGGATCTGAAGATTAAGGTTCAGGATCTGATTGGTAAATTCAAGAAGCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link