tnni2b.2

Ensembl ID:
ENSDARG00000029995
ZFIN ID:
ZDB-GENE-040801-9
Description:
troponin I, skeletal, fast 2b.2 [Source:RefSeq peptide;Acc:NP_001003423]
Human Orthologue:
TNNI2
Human Description:
troponin I type 2 (skeletal, fast) [Source:HGNC Symbol;Acc:11946]
Mouse Orthologue:
Tnni2
Mouse Description:
troponin I, skeletal, fast 2 Gene [Source:MGI Symbol;Acc:MGI:105070]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17285 Essential Splice Site Available for shipment Available now
sa38632 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17285
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099001 Essential Splice Site 27 187 3 6
ENSDART00000139240 Essential Splice Site 16 176 5 8
ENSDART00000146702 Essential Splice Site 16 176 4 7
Genomic Location (Zv9):
Chromosome 7 (position 40784647)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39120904
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCTGGCCAGTGTTAAATATCCAAGTGGCATTTGTTCATTGTTTGTTGT[A/C]GAGTTTGATTCTGGGTATAGCCAAAGACCTGCTGTCGGCTGAGCAGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38632
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099001 Nonsense 101 187 5 6
ENSDART00000139240 Nonsense 90 176 7 8
ENSDART00000146702 Nonsense 90 176 6 7
Genomic Location (Zv9):
Chromosome 7 (position 40785049)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39121306
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACTTTGGCTTGAATTTACAGCACATCACACTCTGTATTCTTGTAGATT[G/T]AGGATCTGAAGATTAAGGTTCAGGATCTGATTGGTAAATTCAAGAAGCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link