adcyap1r1

Ensembl ID:
ENSDARG00000029989
ZFIN IDs:
ZDB-GENE-050315-1, ZDB-GENE-050315-1
Description:
adenylate cyclase activating polypeptide 1 receptor 1 isoform 1 [Source:RefSeq peptide;Acc:NP_00101
Human Orthologue:
ADCYAP1R1
Human Description:
adenylate cyclase activating polypeptide 1 (pituitary) receptor type I [Source:HGNC Symbol;Acc:242]
Mouse Orthologue:
Adcyap1r1
Mouse Description:
adenylate cyclase activating polypeptide 1 receptor 1 Gene [Source:MGI Symbol;Acc:MGI:108449]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14546 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14546
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043448 Nonsense 172 331 7 11
ENSDART00000074441 Nonsense 172 195 7 8
ENSDART00000074443 Nonsense 172 303 7 10
ENSDART00000127935 Nonsense 170 299 8 11
Genomic Location:
Chromosome 2 (position 52545517)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TWGGGATCATCATAATCCTGGTGCAGAAGCTTCAGTCTCCAGACATCGGC[G/T]GAAAYGAGTCCAGCATTTATCTGTGAGTGTGTGTRTCTGTGTGTNNCTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Major depressive disorder: Genome-wide association analysis of gender differences in major depressive disorder in the Netherlands NESDA and NTR population-based samples. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tuhe8hdc