
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
adcyap1r1
- Ensembl ID:
- ENSDARG00000029989
- ZFIN IDs:
- ZDB-GENE-050315-1, ZDB-GENE-050315-1
- Description:
- adenylate cyclase activating polypeptide 1 receptor 1 isoform 1 [Source:RefSeq peptide;Acc:NP_00101
- Human Orthologue:
- ADCYAP1R1
- Human Description:
- adenylate cyclase activating polypeptide 1 (pituitary) receptor type I [Source:HGNC Symbol;Acc:242]
- Mouse Orthologue:
- Adcyap1r1
- Mouse Description:
- adenylate cyclase activating polypeptide 1 receptor 1 Gene [Source:MGI Symbol;Acc:MGI:108449]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa14546 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa14546
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000043448 | Nonsense | 172 | 331 | 7 | 11 |
ENSDART00000074441 | Nonsense | 172 | 195 | 7 | 8 |
ENSDART00000074443 | Nonsense | 172 | 303 | 7 | 10 |
ENSDART00000127935 | Nonsense | 170 | 299 | 8 | 11 |
- Genomic Location (Zv9):
- Chromosome 2 (position 52545517)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 51138344 GRCz11 2 50872564 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TWGGGATCATCATAATCCTGGTGCAGAAGCTTCAGTCTCCAGACATCGGC[G/T]GAAAYGAGTCCAGCATTTATCTGTGAGTGTGTGTRTCTGTGTGTNNCTCA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Major depressive disorder: Genome-wide association analysis of gender differences in major depressive disorder in the Netherlands NESDA and NTR population-based samples. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: