adcyap1r1

Ensembl ID:: ENSDARG00000029989
ZFIN IDs:: ZDB-GENE-050315-1, ZDB-GENE-050315-1
Description:: adenylate cyclase activating polypeptide 1 receptor 1 isoform 1 [Source:RefSeq peptide;Acc:NP_00101
Human Orthologue:: ADCYAP1R1
Human Description:: adenylate cyclase activating polypeptide 1 (pituitary) receptor type I [Source:HGNC Symbol;Acc:242]
Mouse Orthologue:: Adcyap1r1
Mouse Description:: adenylate cyclase activating polypeptide 1 receptor 1 Gene [Source:MGI Symbol;Acc:MGI:108449]

Alleles

There is 1 allele of this gene:

Allele name	Consequence	Status	Availability Estimate
sa14546	Nonsense	Available for shipment	Available now

Mutation Details

Allele Name:: sa14546
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: G > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000043448	Nonsense	172	331	7	11
ENSDART00000074441	Nonsense	172	195	7	8
ENSDART00000074443	Nonsense	172	303	7	10
ENSDART00000127935	Nonsense	170	299	8	11

Genomic Location:: Chromosome 2 (position 52545517)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: TWGGGATCATCATAATCCTGGTGCAGAAGCTTCAGTCTCCAGACATCGGC[G/T]GAAAYGAGTCCAGCATTTATCTGTGAGTGTGTGTRTCTGTGTGTNNCTCA
Associated Phenotype:: Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Major depressive disorder: Genome-wide association analysis of gender differences in major depressive disorder in the Netherlands NESDA and NTR population-based samples. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

OMIM information for ADCYAP1R1

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: