glb1l

Ensembl ID:
ENSDARG00000029955
ZFIN ID:
ZDB-GENE-050309-196
Description:
beta-galactosidase-1-like protein [Source:RefSeq peptide;Acc:NP_001116328]
Human Orthologue:
GLB1L
Human Description:
galactosidase, beta 1-like [Source:HGNC Symbol;Acc:28129]
Mouse Orthologue:
Glb1l
Mouse Description:
galactosidase, beta 1-like Gene [Source:MGI Symbol;Acc:MGI:1921827]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2491 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa2491
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047191 Essential Splice Site 408 629 12 16
Genomic Location (Zv9):
Chromosome 9 (position 13137478)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12890043
KASP Assay ID:
554-2780.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGTCCAGTACGATCTCAATACCCCTTGACATTTGAGGAGATTAAACAA[G/A]TTAGTATATTTAAAATGAGCGTAATTGAAGAGTTCCGATGCAAAAACCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link