ampd2

Ensembl ID:
ENSDARG00000029952
ZFIN ID:
ZDB-GENE-070713-5
Description:
Adenosine monophosphate deaminase 2 (Isoform L) [Source:UniProtKB/TrEMBL;Acc:B8JIS2]
Human Orthologue:
AMPD2
Human Description:
adenosine monophosphate deaminase 2 [Source:HGNC Symbol;Acc:469]
Mouse Orthologue:
Ampd2
Mouse Description:
adenosine monophosphate deaminase 2 Gene [Source:MGI Symbol;Acc:MGI:88016]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2452 Nonsense F2 line generated During 2014
sa21296 Nonsense Mutation detected in F1 DNA During 2014
sa16131 Nonsense Available for shipment Available now
sa5481 Nonsense Mutation detected in F1 DNA During 2014
sa10749 Essential Splice Site Available for shipment Available now
sa872 Nonsense Available for shipment Available now
sa3684 Nonsense Mutation detected in F1 DNA During 2014
sa7613 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2452
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045798 Nonsense 64 230 2 6
ENSDART00000093090 Nonsense 40 793 1 17
ENSDART00000121932 Nonsense 64 334 2 9
ENSDART00000143554 Nonsense 6 756 2 18
Genomic Location:
Chromosome 8 (position 26120861)
KASP Assay ID:
554-3166.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACCAAGCAYGGCCACATTGACCTACGCACCTCCATGGATGGCAAATAC[A/T]AAGAGATTGCAGAGGTAAACAAAGCACAAATCACAACACCGACTCTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21296
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045798 Nonsense 120 230 4 6
ENSDART00000093090 Nonsense 96 793 3 17
ENSDART00000121932 Nonsense 120 334 4 9
ENSDART00000143554 Nonsense 62 756 4 18
Genomic Location:
Chromosome 8 (position 26123658)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTTAATTAAATGCTTATTCTCTTGAGGTTTGAGCCTGATATCCTTCTA[C/T]GAGCCAAACAGGACTTCATGAAAACAGACAGCGCTACGGACCTGGAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16131
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045798 Nonsense 148 230 5 6
ENSDART00000093090 Nonsense 124 793 4 17
ENSDART00000121932 Nonsense 148 334 5 9
ENSDART00000143554 Nonsense 90 756 5 18
Genomic Location:
Chromosome 8 (position 26124472)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTTTCAGGTATATGAAAGAACAGAGCCAGACACCCATAGAAAACTA[T/A]CCCGAGAGAGAGCTYATCCCRGAGAGAGAGTACCAGAGAGTCACTATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5481
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045798 None None 230 None 6
ENSDART00000093090 Nonsense 574 793 13 17
ENSDART00000121932 None None 334 None 9
ENSDART00000143554 Nonsense 537 756 14 18
Genomic Location:
Chromosome 8 (position 26136295)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAAACCTGTCAACTGGACGGATGAAGACAATCCTCCATACTCKTATTA[T/A]CTGTACTACATGTATGCAAATATGACTGTACTCAACCACCTGCGCAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10749
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045798 None None 230 None 6
ENSDART00000093090 Essential Splice Site 590 793 14 17
ENSDART00000121932 None None 334 None 9
ENSDART00000143554 Essential Splice Site 553 756 15 18
Genomic Location:
Chromosome 8 (position 26136682)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTTAGATMACTTGAGGATGAGTAAACTGCATTATTTATGTCTCTCAAC[A/T]GGCAAAGAAACATGAATTCGTTCGTGTTRCGYCCTCACTGTGGAGAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa872
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045798 None None 230 None 6
ENSDART00000093090 Nonsense 636 793 15 17
ENSDART00000121932 None None 334 None 9
ENSDART00000143554 Nonsense 599 756 16 18
Genomic Location:
Chromosome 8 (position 26141845)
KASP Assay ID:
554-0774.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTTGAGTGATATGTTGCTGTATTTCCCACAGGCTCCTGTACTGCAGTA[T/A]CTGTATTATCTGGCTCAGATTGGCATTGCTATGTCGCCGCTCAGCAACAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa3684
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045798 None None 230 None 6
ENSDART00000093090 Nonsense 638 793 15 17
ENSDART00000121932 None None 334 None 9
ENSDART00000143554 Nonsense 601 756 16 18
Genomic Location:
Chromosome 8 (position 26141851)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGATATGTTGCTGTATTTCCCACAGGCTCCTGTACTGCAGTAWCTGTA[T/A]TATCTGGCTCAGATTGGCATTGCTATGTCGCCGCTCAGCAACAACAGYCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7613
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045798 None None 230 None 6
ENSDART00000093090 Missense 730 793 17 17
ENSDART00000121932 None None 334 None 9
ENSDART00000143554 Missense 693 756 18 18
Genomic Location:
Chromosome 8 (position 26144192)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGCATTTATCTGACCTATTCAAATGTCTTCTGTGAAGGTGAAAAGCTAC[T/C]GGTTGGGGCCGCATTAYATAAAAGAGGGACAAGAGGGCAATGACAWCMGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hrdap4n3