atp13a

Ensembl ID:
ENSDARG00000029931
ZFIN ID:
ZDB-GENE-040426-2804
Description:
probable cation-transporting ATPase 13A1 [Source:RefSeq peptide;Acc:NP_001001403]
Human Orthologue:
ATP13A1
Human Description:
ATPase type 13A1 [Source:HGNC Symbol;Acc:24215]
Mouse Orthologue:
Atp13a1
Mouse Description:
ATPase type 13A1 Gene [Source:MGI Symbol;Acc:MGI:2180801]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20141 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13862 Essential Splice Site Available for shipment Available now
sa20142 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20141
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042147 Essential Splice Site 373 887 6 18
ENSDART00000058958 Essential Splice Site 392 1242 6 25
Genomic Location:
Chromosome 3 (position 53551441)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTGTGGATGAAGCCATGCTTACAGGAGAGTCTGTGCCGCAGATGAAG[G/A]TGCGTCTGCTTGCTTTTTCCACTTCAAACTATTATACCATCAGCTTTCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13862
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042147 Essential Splice Site 373 887 6 18
ENSDART00000058958 Essential Splice Site 392 1242 6 25
Genomic Location:
Chromosome 3 (position 53551442)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTGTGGATGAAGCCATGCTYACAGGAGAGTCTGTGCCGCAGATGAARG[T/A]GCGTCTGCTBGCTTTTWCCACTTCHAWCTAYTATACCATCAGCTYTCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20142
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042147 Essential Splice Site 616 887 12 18
ENSDART00000058958 Essential Splice Site 635 1242 12 25
Genomic Location:
Chromosome 3 (position 53561834)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCCTGGAGAAGGCTATGCTGACCGCAGCAGACTGGACGCTCACTAAAG[G/A]TCTGATTAATACACTGCACAAGACAAAGGCTGAGCCACACACCATCATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/l20kfk5c