si:ch211-257p7.1

Ensembl ID:
ENSDARG00000029925
ZFIN IDs:
ZDB-GENE-050222-3, ZDB-GENE-091204-73
Description:
Discs large homolog 1-like protein [Source:UniProtKB/Swiss-Prot;Acc:Q5PYH5]
Human Orthologue:
DLG1
Human Description:
discs, large homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:2900]
Mouse Orthologue:
Dlg1
Mouse Description:
discs, large homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:107231]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1431 Nonsense Available for shipment Available now
sa10085 Nonsense Available for shipment Available now
sa15931 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1431
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043795 Nonsense 62 827 2 22
ENSDART00000061429 Nonsense 133 906 4 25
ENSDART00000134260   None 192 None 4
Genomic Location (Zv9):
Chromosome 2 (position 4883452)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5154388
KASP Assay ID:
554-1359.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCACAGGAGCCGAGTTCRCCACAGTTCACCGATGATACTCCTGGGCCT[G/T]AGCTGGTGCAAGTGGCTGAGAAGAGCCTCYCCCAGATTGAAAATGTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10085
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043795 Nonsense 231 827 7 22
ENSDART00000061429 Nonsense 296 906 9 25
ENSDART00000134260   None 192 None 4
Genomic Location (Zv9):
Chromosome 2 (position 4837572)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5108156
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACGAGGTGGACGTCAGAGAYGTCACCCACAGTAAGGCYGTGGAGGCKT[T/A]GAAGGAGGCAGGCTCSCTGGTCAGACTGTATGTCAGGAGGAGAAAATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15931
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043795 Nonsense 569 827 14 22
ENSDART00000061429 Nonsense 634 906 16 25
ENSDART00000134260   None 192 None 4
Genomic Location (Zv9):
Chromosome 2 (position 4813780)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5084363
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTCAACGCTTCAGATGACGAGTGGTGGCAGGCCAGACAGGTCACAGCT[C/T]AAGGAGAGGTGGAGGAGATGGGGGTTATCCCCAGCAAGAGGAGGTGAGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link