trim54

Ensembl ID:
ENSDARG00000029907
ZFIN ID:
ZDB-GENE-041014-342
Description:
tripartite motif-containing protein 54 [Source:RefSeq peptide;Acc:NP_001038490]
Human Orthologue:
TRIM54
Human Description:
tripartite motif-containing 54 [Source:HGNC Symbol;Acc:16008]
Mouse Orthologue:
Trim54
Mouse Description:
tripartite motif-containing 54 Gene [Source:MGI Symbol;Acc:MGI:1889623]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23777 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23777
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049430 Nonsense 210 433 5 9
ENSDART00000061394 Nonsense 210 433 5 8
ENSDART00000140275 Nonsense 57 122 3 3
Genomic Location:
Chromosome 20 (position 38768459)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACTTAGATACAGTATCTGGTCATCTTTTGCAGGACAATGGTCGGCGG[C/T]AGATACAGCACATATCTGACAAGTTTGATGAACTTTACGCCATTCTAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5bjd56rv