kcnh2

Ensembl ID:
ENSDARG00000029881
ZFIN ID:
ZDB-GENE-070912-699
Description:
microtubule-associated protein 4 [Source:RefSeq peptide;Acc:NP_001036187]
Human Orthologue:
KCNH2
Human Description:
potassium voltage-gated channel, subfamily H (eag-related), member 2 [Source:HGNC Symbol;Acc:6251]
Mouse Orthologue:
Kcnh2
Mouse Description:
potassium voltage-gated channel, subfamily H (eag-related), member 2 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14572 Nonsense Available for shipment Available now
sa19755 Nonsense Available for shipment Available now
sa19754 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14572
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024058 Nonsense 161 1253 4 15
Genomic Location:
Chromosome 2 (position 23758856)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTARYACAATACATTTATTTCTTACCCTTGGGTATTTCCTCAGCAAGA[C/T]GACGTCGTCTCCGGCTGCCACTGCCCTTGCTGCACTCTCTGAGTGGCAGK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19755
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024058 Nonsense 267 1253 4 15
Genomic Location:
Chromosome 2 (position 23758536)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCCCCACGTCTGCACAACCTCACCTCAGAGGCGTCTCCGTCCAGTTG[C/A]AGCATGGCCCACAGCCGCTCCTGTGAGAGCCTGTGTGGCATGAGGCCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19754
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024058 Nonsense 1229 1253 15 15
Genomic Location:
Chromosome 2 (position 23695967)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAAGCTGTACAGAGTTTACATTTGGAGACCTCTGAGTGTTCAAGACGC[C/T]AATCGCTGCCAGTAAAACATCAGGTCGAAGATGATTGCTCAATGCAGAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jrv4m0u9