khk

Ensembl ID:
ENSDARG00000029874
ZFIN IDs:
ZDB-GENE-040718-381, ZDB-GENE-040718-381
Description:
ketohexokinase [Source:RefSeq peptide;Acc:NP_001002636]
Human Orthologue:
KHK
Human Description:
ketohexokinase (fructokinase) [Source:HGNC Symbol;Acc:6315]
Mouse Orthologue:
Khk
Mouse Description:
ketohexokinase Gene [Source:MGI Symbol;Acc:MGI:1096353]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36349 Nonsense Mutation detected in F1 DNA During 2016
sa17705 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36349
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048440 Nonsense 156 299 5 8
ENSDART00000105218 Nonsense 156 299 5 8
Genomic Location (Zv9):
Chromosome 17 (position 12279136)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12261658
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCGTAATGCTGACGAACAAGTGAAGATGATTGAGAGGGTGAGAGAGTA[T/G]AACAAAAAACAAGACGAGAAGAACAGAATCGCCATCTCAGTGGAAATCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17705
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048440 Essential Splice Site 189 299 6 8
ENSDART00000105218 Essential Splice Site 189 299 6 8
Genomic Location (Zv9):
Chromosome 17 (position 12281488)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12264010
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGCATACATGTTTGGACACCGCRTAAYCTGTGTTATCTGTTTTYACTC[A/T]GGTCTTTGTTAGTAAGGATGTGGCCCAGCACTTTGGGTTYGAMTCAGCTR
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link