rassf2

Ensembl ID:
ENSDARG00000029865
ZFIN ID:
ZDB-GENE-040912-124
Description:
ras association domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_001004676]
Human Orthologue:
RASSF2
Human Description:
Ras association (RalGDS/AF-6) domain family member 2 [Source:HGNC Symbol;Acc:9883]
Mouse Orthologue:
Rassf2
Mouse Description:
Ras association (RalGDS/AF-6) domain family member 2 Gene [Source:MGI Symbol;Acc:MGI:2442060]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2417 Essential Splice Site F2 line generated During 2017
sa41277 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa2417
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048819 Essential Splice Site 94 325 4 10
ENSDART00000142671 Essential Splice Site 94 129 4 5
ENSDART00000146632 Essential Splice Site None 61 4 7
Genomic Location (Zv9):
Chromosome 8 (position 45063755)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43016537
KASP Assay ID:
554-2535.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCCTCCTCCACCTCCTGGCACTCGGGCTGTAATCTAGACAACCAGAGG[T/C]CAGATGGTGAACAAGCATATTTAAATGAGCTCTTTAACCTTCTAGAAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41277
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048819 Nonsense 149 325 6 10
ENSDART00000142671   None 129 None 5
ENSDART00000146632   None 61 6 7
Genomic Location (Zv9):
Chromosome 8 (position 45078646)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43031428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGATGTCTCCGCTCAGCTTCTCAGAACTAAGAGCGATGCAGGCGTAT[T/A]GAGGCGGGGCCGGAGACGGTCTCCTAGTGACCAGCGGAGAATCAGACGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link