si:ch211-241d21.5

Ensembl ID:
ENSDARG00000029859
ZFIN ID:
ZDB-GENE-081104-194
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JJJ7]
Human Orthologue:
C1orf228
Human Description:
chromosome 1 open reading frame 228 [Source:HGNC Symbol;Acc:34345]
Mouse Orthologue:
Gm1661
Mouse Description:
predicted gene 1661 Gene [Source:MGI Symbol;Acc:MGI:2686507]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21248 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21248
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110249 Nonsense 65 410 1 11
ENSDART00000131764 Nonsense 65 270 2 7
ENSDART00000135504   None 286 None 9
ENSDART00000143036 Nonsense 52 228 2 6
ENSDART00000145986 Nonsense 65 267 2 6

The following transcripts of ENSDARG00000029859 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 18748015)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18192903
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAGTTTGCTCAAGTCGCCAGCCTGTTCCTGTCTCGACTCACTGCCTG[G/A]TTAAGACTAACGTATCCACACAAAATACTCATGTTTTACAAGGAGGTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link