cnn3b

Ensembl ID:
ENSDARG00000029856
ZFIN ID:
ZDB-GENE-050522-263
Description:
calponin 3, acidic b [Source:RefSeq peptide;Acc:NP_001019244]
Human Orthologue:
CNN3
Human Description:
calponin 3, acidic [Source:HGNC Symbol;Acc:2157]
Mouse Orthologue:
Cnn3
Mouse Description:
calponin 3, acidic Gene [Source:MGI Symbol;Acc:MGI:1919244]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8801 Nonsense Mutation detected in F1 DNA During 2014
sa18722 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8801
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058484 Nonsense 266 331 7 7
ENSDART00000145893 Nonsense 225 290 6 6
ENSDART00000058484 Nonsense 266 331 7 7
ENSDART00000145893 Nonsense 225 290 6 6
Genomic Location:
Chromosome 2 (position 14894973)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YCAACAAAGTGGCCTCTCAAAAGGGCATGAGCGTGTACGGGCTGGGCAGA[C/T]AGGTGTATGACCCCAAATACTGCTCCTCACCCACTGAGCCCACTATCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18722
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058484 Nonsense 266 331 7 7
ENSDART00000145893 Nonsense 225 290 6 6
ENSDART00000058484 Nonsense 266 331 7 7
ENSDART00000145893 Nonsense 225 290 6 6
Genomic Location:
Chromosome 2 (position 14894973)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAACAAAGTGGCCTCTCAAAAGGGCATGAGCGTGTACGGGCTGGGCAGA[C/T]AGGTGTATGACCCCAAATACTGCTCCTCACCCACTGAGCCCACTATCCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Stearic acid (18:0) plasma levels: Genome-wide association study identifies novel loci associated with concentrations of four plasma phospholipid fatty acids in the de novo lipogenesis pathway: results from the Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dj2qdwze