LOC100006263

Ensembl ID:
ENSDARG00000029838

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26877 Nonsense Mutation detected in F1 DNA During 2016
sa40830 Nonsense Mutation detected in F1 DNA During 2016
sa20856 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa26877
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056177 Nonsense 137 662 2 9
Genomic Location (Zv9):
Chromosome 7 (position 6780931)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 5815269
KASP Assay ID:
2259-8406.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGACAGAAACCGTGTAAAGTTACAGTCTGATGGTCATTACACTGTAAAC[A/T]GAGACACTCTCACTATCAGAGGAGCTGCTGAGTCTGATCAGGGTCAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40830
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056177 Nonsense 154 662 2 9
Genomic Location (Zv9):
Chromosome 7 (position 6780984)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 5815322
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACACTCTCACTATCAGAGGAGCTGCTGAGTCTGATCAGGGTCAGTACTG[G/A]TGTAAAGGATTCATAGATGGAAGATCAGTCTCAACACAACCAACATCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20856
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056177 Nonsense 249 662 3 9
Genomic Location (Zv9):
Chromosome 7 (position 6781620)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 5815958
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATGAAGATTGATTCATTGTCTGATGGAGGCCAGTACTGGTGTAGAGCT[G/T]GAAGAGGAGAACCAGTCTATTACACACAATACAGTGATGAACTGACACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link