myf6

Ensembl ID:
ENSDARG00000029830
ZFIN ID:
ZDB-GENE-040309-2
Description:
Myogenic factor 6 [Source:UniProtKB/Swiss-Prot;Acc:Q6VNZ9]
Human Orthologue:
MYF6
Human Description:
myogenic factor 6 (herculin) [Source:HGNC Symbol;Acc:7566]
Mouse Orthologue:
Myf6
Mouse Description:
myogenic factor 6 Gene [Source:MGI Symbol;Acc:MGI:97253]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu2041 Nonsense Confirmed mutation in F2 line Unknown
sa16975 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu2041
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040266 Nonsense 84 239 1 3
Genomic Location:
Chromosome 4 (position 20653734)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAGGCGCACTGCGAGGGTCAGTGCCTCATGTGGGCTTGCAAGATCTG[T/A]AAACGGAAATCTGCTCCTACTGACCGGCGAAAGGCCGCCACTTTGAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16975
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040266 Nonsense 176 239 2 3
Genomic Location:
Chromosome 4 (position 20654139)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAATGNNNNTTTTTCCATCATGATTGCCTGTTCAGGTKACTCCCAGTGAGTA[T/A]CATTGGAAAAAGACCTGCCAGAGCTGGCAGGAGAACCCAGATCATTCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0v6qsl61