A8DZE3_DANRE

Ensembl ID:
ENSDARG00000029805
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A8DZE3]
Human Orthologue:
KIAA0355
Human Description:
KIAA0355 [Source:HGNC Symbol;Acc:29016]
Mouse Orthologue:
4931406P16Rik
Mouse Description:
RIKEN cDNA 4931406P16 gene Gene [Source:MGI Symbol;Acc:MGI:1924311]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35606 Nonsense Mutation detected in F1 DNA During 2016
sa7380 Missense Mutation detected in F1 DNA During 2016
sa13262 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35606
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049374 Nonsense 119 799 1 12
Genomic Location (Zv9):
Chromosome 13 (position 51966756)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 480364
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCTTTGGCAGCGTTTTCCGGGACTCCCGTTACTCCAAAGCAGCTATG[C/T]AACTGAAGGACGTGCAGGAACATGTCATGGAAACGACCAGCCGGCTCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7380
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049374 Missense 147 799 1 12
Genomic Location (Zv9):
Chromosome 13 (position 51966671)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 480279
KASP Assay ID:
554-4370.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCAGCCGGCTCACCACAGCAATAAAGYCAGAGATCGGCAAAATGCTGA[T/C]GGAGCTCAGCGCAGGCGCGGCTAACTTCAAAGACCAGAAYGACTTCAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13262
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049374 Nonsense 776 799 12 12
Genomic Location (Zv9):
Chromosome 13 (position 51939532)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 455012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGGAGATGCTGGGACACAAGCCTCCGCAGGGGCCGCGCAACAACACCTG[G/A]CCTAACCGAGAGCAGAGCGAGCAGAGCTTGTTTGGGGTGCWGGGAGACTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Functional MRI: A genome-wide association study of amygdala activation in youths with and without bipolar disorder. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link