si:ch211-87m5.3

Ensembl ID:
ENSDARG00000029803
ZFIN ID:
ZDB-GENE-070912-324
Description:
Novel protein similar to vertebrate oxoglutarate (Alpha-ketoglutarate) receptor 1 (OXGR1) [Source:Un
Human Orthologue:
OXGR1
Human Description:
oxoglutarate (alpha-ketoglutarate) receptor 1 [Source:HGNC Symbol;Acc:4531]
Mouse Orthologue:
Oxgr1
Mouse Description:
oxoglutarate (alpha-ketoglutarate) receptor 1 Gene [Source:MGI Symbol;Acc:MGI:2685145]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21500 Nonsense Available for shipment Available now
sa34664 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21500
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044743 Nonsense 97 282 1 1
Genomic Location (Zv9):
Chromosome 9 (position 30359388)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29515334
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTACAACCTGTATGGCAGCATCCTCTTCCTTACCTGCCTCAGCATCTTC[A/T]GATATGTCGCAGTGGTGCATCCGTTAAAGGCTGCAGAGATTCGAAGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34664
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044743 Nonsense 198 282 1 1
Genomic Location (Zv9):
Chromosome 9 (position 30359691)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29515637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGCTACACTCGCATTGCAGGCATTCTAGGCTCCAGCATATCCAGAAAC[A/T]GACAGAGTCGCTCCAGGGTGCGCATGCTCACCATTCTAATTCTGGTGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link