gb:co360592

Ensembl ID:
ENSDARG00000029789
ZFIN ID:
ZDB-GENE-071015-3
Human Orthologue:
C11orf65
Human Description:
chromosome 11 open reading frame 65 [Source:HGNC Symbol;Acc:28519]
Mouse Orthologue:
4930550C14Rik
Mouse Description:
RIKEN cDNA 4930550C14 gene Gene [Source:MGI Symbol;Acc:MGI:1922561]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44143 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44143
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043609 Nonsense 219 292 6 9
Genomic Location (Zv9):
Chromosome 24 (position 24585178)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23832056
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACACAGTAAAACAGCACAACAACTTCAGAATTCCCCAGAGACATTGT[T/A]GGATTCATTTGAAACTTCCGACTTTGAGCAGGAAGTGGATGAGCTGCTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link