NP_001074067.1

Ensembl ID:
ENSDARG00000029772
Description:
actin binding LIM protein family, member 3 [Source:RefSeq peptide;Acc:NP_001074067]
Human Orthologue:
ABLIM3
Human Description:
actin binding LIM protein family, member 3 [Source:HGNC Symbol;Acc:29132]
Mouse Orthologue:
Ablim3
Mouse Description:
actin binding LIM protein family, member 3 Gene [Source:MGI Symbol;Acc:MGI:2442582]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa306 Nonsense Confirmed mutation in F2 line During 2017
sa184 Nonsense Confirmed mutation in F2 line During 2017

Mutation Details

Allele Name:
sa306
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041834 Nonsense 179 631 5 22
ENSDART00000052595 Nonsense 179 683 5 23
ENSDART00000138743   None 132 None 6

The following transcripts of ENSDARG00000029772 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 43364215)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34355919
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATCTCTGCTGGCGTTGGAGAAGCAGTGGCACGTCAGCTGCTTCAGGTG[T/A]CAGACCTGCGGCCTCGTCCTGACCGGAGAGTATATCAGCAAGTGAGTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa184
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041834   None 631 None 22
ENSDART00000052595 Nonsense 330 683 10 23
ENSDART00000138743   None 132 None 6

The following transcripts of ENSDARG00000029772 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 43383627)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34336507
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTAAGGTTAAAGCCATTTATGAAGTGCAGAGGCCAGACTACTGGTCCTA[T/A]GAGTCGAGTCACAGATACTGCTCCGATGACAGGCTAGAGCGCCTCAGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link