nr1i2

Ensembl ID:
ENSDARG00000029766
ZFIN ID:
ZDB-GENE-030903-3
Description:
nuclear receptor subfamily 1 group I member 2 [Source:RefSeq peptide;Acc:NP_001092087]
Human Orthologue:
NR1I2
Human Description:
nuclear receptor subfamily 1, group I, member 2 [Source:HGNC Symbol;Acc:7968]
Mouse Orthologue:
Nr1i2
Mouse Description:
nuclear receptor subfamily 1, group I, member 2 Gene [Source:MGI Symbol;Acc:MGI:1337040]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1903 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa1903
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017326   None 430 None 9
ENSDART00000061525 Essential Splice Site None 430 10 10
ENSDART00000123247   None 430 None 10
ENSDART00000125174   None 430 9 9
ENSDART00000126964   None 327 None 8
Genomic Location (Zv9):
Chromosome 9 (position 9783633)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 9584184
KASP Assay ID:
554-1893.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAYAGTGAACTTAATCCATTTGAGTAAACAAAGCAATTTGAGCACAGTGA[G/A]GCCCAATAAATGAAGAGAACTCAAACCTACTGAGTACTGTAATACCCAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link