mef2ca

Ensembl ID:
ENSDARG00000029764
ZFIN ID:
ZDB-GENE-980526-253
Description:
myocyte enhancer factor 2ca [Source:RefSeq peptide;Acc:NP_571387]
Human Orthologue:
MEF2C
Human Description:
myocyte enhancer factor 2C [Source:HGNC Symbol;Acc:6996]
Mouse Orthologue:
Mef2c
Mouse Description:
myocyte enhancer factor 2C Gene [Source:MGI Symbol;Acc:MGI:99458]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2569 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa2569
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027392 Essential Splice Site 134 491 5 11
ENSDART00000039551 Essential Splice Site 134 449 6 10
ENSDART00000097433 Essential Splice Site 48 363 2 6
ENSDART00000099134 Essential Splice Site 134 465 6 11
ENSDART00000131309 Essential Splice Site 49 380 2 7
ENSDART00000131731 Essential Splice Site 48 379 2 7
ENSDART00000134219 None None 86 None 2
ENSDART00000134953 None None 86 None 2
ENSDART00000138962 None None 86 None 2
Genomic Location:
Chromosome 10 (position 45084058)
KASP Assay ID:
554-3376.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAATGTCTGCTTTWCGTAATGGACTGATTTCCATGCMTTCTGTTTTCC[A/G]GGCCATCCCTCAGTCTAACTACGACATGCCTGTCTCCATCCCCGTCAGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xfk3nn73