mef2ca

Ensembl ID:
ENSDARG00000029764
ZFIN ID:
ZDB-GENE-980526-253
Description:
myocyte enhancer factor 2ca [Source:RefSeq peptide;Acc:NP_571387]
Human Orthologue:
MEF2C
Human Description:
myocyte enhancer factor 2C [Source:HGNC Symbol;Acc:6996]
Mouse Orthologue:
Mef2c
Mouse Description:
myocyte enhancer factor 2C Gene [Source:MGI Symbol;Acc:MGI:99458]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34989 Essential Splice Site Mutation detected in F1 DNA During 2016
sa2569 Essential Splice Site F2 line generated During 2016
sa34988 Nonsense Mutation detected in F1 DNA During 2016
sa31806 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa34989
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027392 Essential Splice Site None 491 2 11
ENSDART00000039551 Essential Splice Site None 449 3 10
ENSDART00000097433   None 363 None 6
ENSDART00000099134 Essential Splice Site None 465 3 11
ENSDART00000131309   None 380 None 7
ENSDART00000131731   None 379 None 7
ENSDART00000134219   None 86 1 2
ENSDART00000134953   None 86 None 2
ENSDART00000138962   None 86 1 2
Genomic Location:
Chromosome 10 (position 45131892)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAACACACTATTTTTCTGATAGAGATCTGTGTGTGTGTTTGTGTGTTC[A/C]GGAACGAAAGCCGGAGTCTTTACAGTGAGCGGAACGAGTGAAGAGGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2569
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027392 Essential Splice Site 134 491 5 11
ENSDART00000039551 Essential Splice Site 134 449 6 10
ENSDART00000097433 Essential Splice Site 48 363 2 6
ENSDART00000099134 Essential Splice Site 134 465 6 11
ENSDART00000131309 Essential Splice Site 49 380 2 7
ENSDART00000131731 Essential Splice Site 48 379 2 7
ENSDART00000134219   None 86 None 2
ENSDART00000134953   None 86 None 2
ENSDART00000138962   None 86 None 2
Genomic Location:
Chromosome 10 (position 45084058)
KASP Assay ID:
554-3376.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAATGTCTGCTTTWCGTAATGGACTGATTTCCATGCMTTCTGTTTTCC[A/G]GGCCATCCCTCAGTCTAACTACGACATGCCTGTCTCCATCCCCGTCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34988
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027392 Nonsense 422 491 10 11
ENSDART00000039551 Nonsense 406 449 10 10
ENSDART00000097433 Nonsense 320 363 6 6
ENSDART00000099134 Nonsense 422 465 11 11
ENSDART00000131309 Nonsense 337 380 7 7
ENSDART00000131731 Nonsense 336 379 7 7
ENSDART00000134219   None 86 None 2
ENSDART00000134953   None 86 None 2
ENSDART00000138962   None 86 None 2
Genomic Location:
Chromosome 10 (position 45070142)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTCGGGACGCTCCCCGGTGGACAGTCTCAGCAGCTGCGGCAGCTCGTA[C/A]GACGGCAGCGACCGCGACGAACACCGCGCAAACTTCCACTCGCCCGTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31806
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027392 Nonsense 471 491 11 11
ENSDART00000039551   None 449 10 10
ENSDART00000097433   None 363 6 6
ENSDART00000099134   None 465 11 11
ENSDART00000131309   None 380 7 7
ENSDART00000131731   None 379 7 7
ENSDART00000134219   None 86 None 2
ENSDART00000134953   None 86 None 2
ENSDART00000138962   None 86 None 2
Genomic Location:
Chromosome 10 (position 45069995)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCATGCGTCTGTCCGAGGCCGGCTGGGCATCCTGAACACCATTGACAAA[C/T]AGCCCTGTGAAAAAGTTTGCACCCCCTATATATTGAGTTTCAAGCTTTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link