mpp6b

Ensembl ID:
ENSDARG00000029761
ZFIN ID:
ZDB-GENE-040426-775
Description:
MAGUK p55 subfamily member 6 [Source:RefSeq peptide;Acc:NP_001038242]
Human Orthologue:
MPP6
Human Description:
membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6) [Source:HGNC Symbol;Acc:18167]
Mouse Orthologue:
Mpp6
Mouse Description:
membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6) Gene [Source:MGI Symbol;Acc:MGI:192

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18546 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18546
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043924 Essential Splice Site 294 539 8 13
ENSDART00000126173 Essential Splice Site 294 539 6 11

The following transcripts of ENSDARG00000029761 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 20556780)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAGAGGAAAAGAGGAAAGCATTTGTTCCTAGAGACCTGGATGGAGCAGG[T/C]AATGCTCGTCAACACACTGCGRTCACCAAAACAGAAAAGATTTTTGATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nl20icx4