mep1a.1

Ensembl ID:
ENSDARG00000029747
ZFIN ID:
ZDB-GENE-041001-209
Description:
meprin A, alpha.1 [Source:RefSeq peptide;Acc:NP_001025452]
Human Orthologue:
MEP1A
Human Description:
meprin A, alpha (PABA peptide hydrolase) [Source:HGNC Symbol;Acc:7015]
Mouse Orthologue:
Mep1a
Mouse Description:
meprin 1 alpha Gene [Source:MGI Symbol;Acc:MGI:96963]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4920 Essential Splice Site Mutation detected in F1 DNA During 2014
sa17730 Nonsense Available for shipment Available now
sa13188 Essential Splice Site Available for shipment Available now
sa10535 Essential Splice Site Available for shipment Available now
sa6643 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4920
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047195 Essential Splice Site 41 598 3 14
ENSDART00000122034 Essential Splice Site 41 598 3 13
ENSDART00000130966 Essential Splice Site 46 603 4 15
Genomic Location:
Chromosome 20 (position 35498272)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCAGAGGTTGAAGATGAACCCAATTTTAACCCTTTCATCAATCTTGG[T/A]AATGTGAAGTGTGCTAATGAGTAATGTGCAGTTTTTGTATTATATTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17730
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047195 Nonsense 206 598 8 14
ENSDART00000122034 Nonsense 206 598 8 13
ENSDART00000130966 Nonsense 211 603 9 15
Genomic Location:
Chromosome 20 (position 35501573)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTCACAGACCTAAACACACCATATGACTAYGAGTCTGTTATGCATTA[T/A]CGTCCATTTGCTTTCAACAAAGACCCCKCTATTCCTACTATTACMACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13188
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047195 Essential Splice Site 525 598 11 14
ENSDART00000122034 Essential Splice Site 525 598 11 13
ENSDART00000130966 Essential Splice Site 530 603 12 15
Genomic Location:
Chromosome 20 (position 35503746)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTTGAGGATGTCTTCTGCTCGTAGCCTCACCACTGACCTGAGCAAAGG[T/C]ATTTGAGGYCATWACCATGTTTGGGGAAACAATGGGGGAAAATCAACWTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10535
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047195 Essential Splice Site 525 598 11 14
ENSDART00000122034 Essential Splice Site 525 598 11 13
ENSDART00000130966 Essential Splice Site 530 603 12 15
Genomic Location:
Chromosome 20 (position 35503746)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTTGAGGATGTCTTCTGCTCGTAGCCTCACCACTGACCTGAGCAAAGG[T/C]ATTTGAGGYCATWACCATGTTTGGGGAAACAATGGGGGAAAATCAACWTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6643
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047195 Nonsense 567 598 12 14
ENSDART00000122034 Nonsense 567 598 12 13
ENSDART00000130966 Nonsense 572 603 13 15
Genomic Location:
Chromosome 20 (position 35505434)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCATCAAAGGGATGGAATACTTTCATAAAGCACTACGATTTACACAGA[C/T]GAAATTACCTGAAAAATGATGACCTCATCATCTTTGTTGACTTTGAAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tkjtv8ph