p2rx3b

Ensembl ID:
ENSDARG00000029718
ZFIN ID:
ZDB-GENE-030319-3
Description:
P2X purinoceptor 3 [Source:RefSeq peptide;Acc:NP_945337]
Human Orthologue:
P2RX3
Human Description:
purinergic receptor P2X, ligand-gated ion channel, 3 [Source:HGNC Symbol;Acc:8534]
Mouse Orthologue:
P2rx3
Mouse Description:
purinergic receptor P2X, ligand-gated ion channel, 3 Gene [Source:MGI Symbol;Acc:MGI:1097160]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31226 Essential Splice Site Available for shipment Available now
sa1216 Nonsense Available for shipment Available now
sa31227 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31226
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049701 Essential Splice Site 198 412 6 13
ENSDART00000133926 Essential Splice Site 198 412 6 12
Genomic Location (Zv9):
Chromosome 1 (position 45205152)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44048371
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCATATTTATCAAGAACAGCATTCGCTTCCCACGTTTTAACTTCACCAA[G/A]TAATGCCAAATTATCATTCATAAATCCTTTATAAGTGTTTGTTTCATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1216
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049701 Nonsense 311 412 9 13
ENSDART00000133926 Nonsense 311 412 9 12
Genomic Location (Zv9):
Chromosome 1 (position 45209764)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44052983
KASP Assay ID:
554-1125.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTTAAAATGGAGAACGGAACTGAGTATCGCACTCTGCTGAAAGCCTA[C/A]GCCATCAGATTTGATGTGCTGGTCAATGGAGATGTGAGTGTTTTTGTGTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa31227
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049701 Essential Splice Site 371 412 None 13
ENSDART00000133926 Essential Splice Site 371 412 None 12
Genomic Location (Zv9):
Chromosome 1 (position 45212216)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44055435
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTGTGATAACAAACTTTGCCTCACCGTGTCTCTCTTGCTCTGTTTTT[A/G]GGTGTCAGATTCAAATATTCAAAGCTCTGGTTCACTGTACAGGACCAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link