LOC557518

Ensembl ID:
ENSDARG00000029689
Human Orthologue:
TKT
Human Description:
transketolase [Source:HGNC Symbol;Acc:11834]
Mouse Orthologue:
Tkt
Mouse Description:
transketolase Gene [Source:MGI Symbol;Acc:MGI:105992]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2606 Essential Splice Site F2 line generated During 2016
sa16202 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2606
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045888 Essential Splice Site 146 628 4 14
Genomic Location (Zv9):
Chromosome 11 (position 37836711)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36729198
KASP Assay ID:
554-3088.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGTAGCCTGTGGAATGGCATATACGGCCAAATACTTTGACAAATCTAG[G/A]TAAGAATAAAGWCATACATTCATGAGAACAGAATATACATYGTTTACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16202
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045888 Essential Splice Site 146 628 4 14
Genomic Location (Zv9):
Chromosome 11 (position 37836712)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36729199
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGTAGCCTGTGGAATGGCATATACRGCCAAATACTTTGACAAATCTAGR[T/G]AAGAATAAAGWCATACATTCATGAGAACAGAATATACATYGTTTACTGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link