
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
crim1
- Ensembl ID:
- ENSDARG00000029668
- ZFIN ID:
- ZDB-GENE-040312-2
- Description:
- Cysteine-rich motor neuron 1 protein [Source:UniProtKB/Swiss-Prot;Acc:Q7T3Q2]
- Human Orthologue:
- CRIM1
- Human Description:
- cysteine rich transmembrane BMP regulator 1 (chordin-like) [Source:HGNC Symbol;Acc:2359]
- Mouse Orthologue:
- Crim1
- Mouse Description:
- cysteine rich transmembrane BMP regulator 1 (chordin like) Gene [Source:MGI Symbol;Acc:MGI:1354756]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23148 | Essential Splice Site | Available for shipment | Available now |
sa42982 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa23147 | Essential Splice Site | Available for shipment | Available now |
sa23146 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa23148
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050534 | Essential Splice Site | 325 | 1027 | 6 | 17 |
ENSDART00000134243 | Essential Splice Site | 325 | 451 | 6 | 7 |
- Genomic Location (Zv9):
- Chromosome 17 (position 39163617)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 39048514 GRCz11 17 38996099 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATACATGCGACAACCTCTAATGCACTGTGTCCTGATTACTGTGTTTTGCA[G/A]AGACAAAGCCAGCCTGCACTTTTAACGGAGTGGAGTACCATGATGGAGAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42982
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050534 | Nonsense | 410 | 1027 | 7 | 17 |
ENSDART00000134243 | Nonsense | 410 | 451 | 7 | 7 |
- Genomic Location (Zv9):
- Chromosome 17 (position 39156913)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 39041810 GRCz11 17 38989395 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTAGCTGGCTGCTATGTGAATGGGCAAATCTTGGCTCACGGTGACCATTG[G/A]CGCGAGGACGACTGCACCTTCTGCCAGTGTGTGAGTGGAGATGCCCGCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23147
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050534 | Essential Splice Site | 588 | 1027 | 10 | 17 |
ENSDART00000134243 | None | 451 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 17 (position 39119546)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 39004443 GRCz11 17 38952028 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGGGATTCCAGCATGATGAATTGGGCTGTCTGATTTGTCAGTGTAGAGG[T/G]AAGTCTATATTTATTCATTTGTTAAGTATTTTATTTGATTTGGTCAGACT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23146
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050534 | Nonsense | 626 | 1027 | 11 | 17 |
ENSDART00000134243 | None | 451 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 17 (position 39114031)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 38998928 GRCz11 17 38946513 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGCATGAGAATGGGCAGAGCTGGCACGACGGATGCAGGGACTGTTACTG[C/A]CATGCTGGAAGAGAAATGTGTGCGCTTATTTCTTGCCCAGTGCCACCCTG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Anthropometric traits: Genome-wide association study of anthropometric traits in Korcula Island, Croatia. (View Study)
- Ventricular conduction: Common variants in 22 loci are associated with QRS duration and cardiac ventricular conduction. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: