crim1

Ensembl ID:: ENSDARG00000029668
ZFIN ID:: ZDB-GENE-040312-2
Description:: Cysteine-rich motor neuron 1 protein [Source:UniProtKB/Swiss-Prot;Acc:Q7T3Q2]
Human Orthologue:: CRIM1
Human Description:: cysteine rich transmembrane BMP regulator 1 (chordin-like) [Source:HGNC Symbol;Acc:2359]
Mouse Orthologue:: Crim1
Mouse Description:: cysteine rich transmembrane BMP regulator 1 (chordin like) Gene [Source:MGI Symbol;Acc:MGI:1354756]

Alleles

There are 3 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa23148	Essential Splice Site	Mutation detected in F1 DNA	During 2015
sa23147	Essential Splice Site	Mutation detected in F1 DNA	During 2015
sa23146	Nonsense	Mutation detected in F1 DNA	During 2015

Mutation Details

Allele Name:: sa23148
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: G > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000050534	Essential Splice Site	325	1027	6	17
ENSDART00000134243	Essential Splice Site	325	451	6	7

Genomic Location:: Chromosome 17 (position 39163617)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: None
Flanking Sequence:: ATACATGCGACAACCTCTAATGCACTGTGTCCTGATTACTGTGTTTTGCA[G/A]AGACAAAGCCAGCCTGCACTTTTAACGGAGTGGAGTACCATGATGGAGAC
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa23147
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: T > G
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000050534	Essential Splice Site	588	1027	10	17
ENSDART00000134243		None	451	None	7

Genomic Location:: Chromosome 17 (position 39119546)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: None
Flanking Sequence:: ATGGGATTCCAGCATGATGAATTGGGCTGTCTGATTTGTCAGTGTAGAGG[T/G]AAGTCTATATTTATTCATTTGTTAAGTATTTTATTTGATTTGGTCAGACT
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa23146
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: C > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000050534	Nonsense	626	1027	11	17
ENSDART00000134243		None	451	None	7

Genomic Location:: Chromosome 17 (position 39114031)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: None
Flanking Sequence:: AGGCATGAGAATGGGCAGAGCTGGCACGACGGATGCAGGGACTGTTACTG[C/A]CATGCTGGAAGAGAAATGTGTGCGCTTATTTCTTGCCCAGTGCCACCCTG
Associated Phenotype:: Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Anthropometric traits: Genome-wide association study of anthropometric traits in Korcula Island, Croatia. (View Study)
Ventricular conduction: Common variants in 22 loci are associated with QRS duration and cardiac ventricular conduction. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

OMIM information for CRIM1

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: