crim1

Ensembl ID:
ENSDARG00000029668
ZFIN ID:
ZDB-GENE-040312-2
Description:
Cysteine-rich motor neuron 1 protein [Source:UniProtKB/Swiss-Prot;Acc:Q7T3Q2]
Human Orthologue:
CRIM1
Human Description:
cysteine rich transmembrane BMP regulator 1 (chordin-like) [Source:HGNC Symbol;Acc:2359]
Mouse Orthologue:
Crim1
Mouse Description:
cysteine rich transmembrane BMP regulator 1 (chordin like) Gene [Source:MGI Symbol;Acc:MGI:1354756]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23148 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23147 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23146 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23148
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050534 Essential Splice Site 325 1027 6 17
ENSDART00000134243 Essential Splice Site 325 451 6 7
Genomic Location:
Chromosome 17 (position 39163617)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACATGCGACAACCTCTAATGCACTGTGTCCTGATTACTGTGTTTTGCA[G/A]AGACAAAGCCAGCCTGCACTTTTAACGGAGTGGAGTACCATGATGGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23147
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050534 Essential Splice Site 588 1027 10 17
ENSDART00000134243 None None 451 None 7
Genomic Location:
Chromosome 17 (position 39119546)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGGATTCCAGCATGATGAATTGGGCTGTCTGATTTGTCAGTGTAGAGG[T/G]AAGTCTATATTTATTCATTTGTTAAGTATTTTATTTGATTTGGTCAGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23146
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050534 Nonsense 626 1027 11 17
ENSDART00000134243 None None 451 None 7
Genomic Location:
Chromosome 17 (position 39114031)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCATGAGAATGGGCAGAGCTGGCACGACGGATGCAGGGACTGTTACTG[C/A]CATGCTGGAAGAGAAATGTGTGCGCTTATTTCTTGCCCAGTGCCACCCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s2iqs9xs