tomm70a

Ensembl ID:
ENSDARG00000029639
ZFIN ID:
ZDB-GENE-030131-8173
Description:
mitochondrial import receptor subunit TOM70 [Source:RefSeq peptide;Acc:NP_956296]
Human Orthologue:
TOMM70A
Human Description:
translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:119
Mouse Orthologue:
Tomm70a
Mouse Description:
translocase of outer mitochondrial membrane 70 homolog A (yeast) Gene [Source:MGI Symbol;Acc:MGI:106

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20715 Essential Splice Site Mutation detected in F1 DNA During 2016
sa14904 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20715
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041998 Essential Splice Site 136 578 2 12
ENSDART00000147285 Essential Splice Site 137 579 2 12
Genomic Location (Zv9):
Chromosome 6 (position 28671706)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28967349
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCTGTCCACCTTCTACCAGAATAGAGCTGCAGCTTATGAGCAACAGG[T/C]TTGTCTAGGTCATGTGATCATTTGAATCCTCTGTAAAGTGTGTTTGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14904
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041998 Nonsense 379 578 7 12
ENSDART00000147285 Nonsense 380 579 7 12
Genomic Location (Zv9):
Chromosome 6 (position 28664473)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28960116
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCTGCAGAGATCGATCACCGTAATGCAGATGTSTATCACCACAGAGRA[C/T]AGGTATGACAACTTGTTGTAACTTTAAAGCAAGCATTTGYGGAATGTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link