tomm70a

Ensembl ID:
ENSDARG00000029639
ZFIN ID:
ZDB-GENE-030131-8173
Description:
mitochondrial import receptor subunit TOM70 [Source:RefSeq peptide;Acc:NP_956296]
Human Orthologue:
TOMM70A
Human Description:
translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:119
Mouse Orthologue:
Tomm70a
Mouse Description:
translocase of outer mitochondrial membrane 70 homolog A (yeast) Gene [Source:MGI Symbol;Acc:MGI:106

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20715 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3574 Nonsense Mutation detected in F1 DNA During 2014
sa14904 Nonsense Available for shipment Available now
sa8233 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20715
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041998 Essential Splice Site 136 578 2 12
ENSDART00000147285 Essential Splice Site 137 579 2 12
Genomic Location:
Chromosome 6 (position 28671706)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCTGTCCACCTTCTACCAGAATAGAGCTGCAGCTTATGAGCAACAGG[T/C]TTGTCTAGGTCATGTGATCATTTGAATCCTCTGTAAAGTGTGTTTGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3574
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041998 Nonsense 379 578 7 12
ENSDART00000147285 Nonsense 380 579 7 12
Genomic Location:
Chromosome 6 (position 28664473)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCTGCAGAGATCGATCACCGTAATGCAGATGTSTATCACCACAGAGGA[C/T]AGGTATGACAACTTGTTGTAACTTTAAAGCAAGCATTTGYGGAATGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14904
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041998 Nonsense 379 578 7 12
ENSDART00000147285 Nonsense 380 579 7 12
Genomic Location:
Chromosome 6 (position 28664473)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCTGCAGAGATCGATCACCGTAATGCAGATGTSTATCACCACAGAGRA[C/T]AGGTATGACAACTTGTTGTAACTTTAAAGCAAGCATTTGYGGAATGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8233
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041998 Nonsense 449 578 9 12
ENSDART00000147285 Nonsense 450 579 9 12
Genomic Location:
Chromosome 6 (position 28663055)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGGTTTTGAGGATGTCATTAGGAGGTTTCCAAAGTGTGCTGAGGGTTA[T/A]GCTCTGTATGCACAGGTACTGCTTATCTTGAGCCCATTTATTTCTGATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/l0hbccab