t54l

Ensembl ID:
ENSDARG00000029612
ZFIN ID:
ZDB-GENE-030616-159
Description:
G patch domain and KOW motifs-containing protein [Source:UniProtKB/Swiss-Prot;Acc:Q90X38]
Human Orthologue:
GPKOW
Human Description:
G patch domain and KOW motifs [Source:HGNC Symbol;Acc:30677]
Mouse Orthologue:
Gpkow
Mouse Description:
G patch domain and KOW motifs Gene [Source:MGI Symbol;Acc:MGI:1859610]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13374 Nonsense Available for shipment Available now
sa21343 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13374
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047912 Nonsense 88 506 2 11
ENSDART00000127435 Nonsense 88 339 2 8
Genomic Location:
Chromosome 8 (position 37729828)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATTATCCCAYTGATCCACAAGAACCGCTGGTACCGACAGGATGCTGAG[C/T]GAGCGGAYAAAACCAGCGAAGAGAAGACCGAAGAACCGTCASAGGTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21343
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047912 Nonsense 230 506 5 11
ENSDART00000127435 Nonsense 230 339 5 8
Genomic Location:
Chromosome 8 (position 37714717)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGGTTGGGTTTGGGTGCTGATCGATCTGCAATTAAAGACCTGGAGCCC[G/T]GAGTCCCCAAGAGACCACCTAAACCTGGAGATGAGAAGGGGAAAGAGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zj86vcgw